View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14570_high_9 (Length: 224)
Name: NF14570_high_9
Description: NF14570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14570_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 47583038 - 47583257
Alignment:
| Q |
1 |
tatcaaattgtattagattagacatgggaaaattagcggtattaatactggtgtgtttgattgcagcaacgattgcagaacaatgcggtagacaagctgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47583038 |
tatcaaattgtattagattagacatgggaaaattagcggtattaatactggtgtgtttgattgcagcaacgattgcagaacaatgcggtagacaagctgg |
47583137 |
T |
|
| Q |
101 |
aggaaaaacatgtccaaacaacctttgttgcagccaatacggttactgtggtaccacagatgaatactgtggtccgaactgtcagagtaactgtcatggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47583138 |
aggaaaaacatgtccaaacaacctttgttgcagccaatacggttactgtggtaccacagatgaatactgtggtccgaactgtcagagtaactgtcatggc |
47583237 |
T |
|
| Q |
201 |
agtagtggtggtggtgaaag |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
47583238 |
agtagtggtggtggtgaaag |
47583257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University