View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14570_low_9 (Length: 300)
Name: NF14570_low_9
Description: NF14570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14570_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 17 - 281
Target Start/End: Original strand, 46686607 - 46686868
Alignment:
| Q |
17 |
caaaggcaagaacaaaacgggtaatttaggaatttcagttgagaatccaacatcaaatttctttcgttacaaactcatagccatcattaaaacaccacca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46686607 |
caaaggcaagaacaaaacgggtaatttaggaatttcagttgagaatccaacatcaaatttctttcgttacaaactcatagccatcattaaaacaccacca |
46686706 |
T |
 |
| Q |
117 |
acttcttggttgtttcccatacaaggaaaacaaagtcaaactttataggatcactaaaaacacgtgtaaactttttggatgttcctttgaagagtnnnnn |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46686707 |
acttcttggttgtttcccatacaaggaaaacaaagtcaaactttataggatcactaaaaacacgtgtaaactttttggatgttcctttgaagagtaaaaa |
46686806 |
T |
 |
| Q |
217 |
nnnccaaattaaacagaacaaaacaaaccgaatttttaaatgagttggatgatagatctcaaaat |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46686807 |
aaaccaaattaaacagaacaaaacaaaccgaatttttaaatgagttg---gatagatctcaaaat |
46686868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University