View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14571_high_3 (Length: 243)
Name: NF14571_high_3
Description: NF14571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14571_high_3 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 243
Target Start/End: Original strand, 39593153 - 39593378
Alignment:
| Q |
17 |
aagatgtgttcagtgttgagcacacgtggtttcattcaattattctgtttttcacattgaaggcatttcaggtgttctcattgatacatgtcggtgtctc |
116 |
Q |
| |
|
||||||||||| ||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39593153 |
aagatgtgttcggtgttgaacacaagtggtttcattcaattattctgtttttcacattgaaggcatttcaggtgttctcattgatacatatcggtgtctc |
39593252 |
T |
 |
| Q |
117 |
tgacaccaacacgacacttatatatgtggcaacattcaattgtttaattttttaaaattattaattaccggtgtcgacgtgtaaatgtcatgtcatacga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39593253 |
tgacaccaacacgacacttatatatgtggctacattcaattaattaa-tttttaaaattattaattaccggtgtcgacgtgtaaatgtcatgtcatacga |
39593351 |
T |
 |
| Q |
217 |
attaatattcatttctttattacctgc |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
39593352 |
attaatattcatttctttattacctgc |
39593378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University