View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14572_high_34 (Length: 366)
Name: NF14572_high_34
Description: NF14572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14572_high_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 1e-35; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 17 - 93
Target Start/End: Complemental strand, 9248594 - 9248518
Alignment:
| Q |
17 |
agtttcagcctgaggttcctacaagggtacctagtgccaggtcaattttttatatctctattgttcttagaacatga |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9248594 |
agtttcagcctgaggttcctacaagggtacctagtgccaggtcaattttttatatctctattgttcttagaacatga |
9248518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 323 - 358
Target Start/End: Complemental strand, 9248281 - 9248246
Alignment:
| Q |
323 |
ctaatcatgtatgtttagtgtttgtttgtgtctctg |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
9248281 |
ctaatcatgtatgtttagtgtttgtttgtgtctctg |
9248246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University