View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14572_high_50 (Length: 284)

Name: NF14572_high_50
Description: NF14572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14572_high_50
NF14572_high_50
[»] chr7 (6 HSPs)
chr7 (33-262)||(5301542-5301782)
chr7 (27-107)||(5290528-5290607)
chr7 (33-116)||(5283561-5283644)
chr7 (102-155)||(5283491-5283544)
chr7 (39-104)||(5309393-5309458)
chr7 (72-133)||(5314159-5314220)


Alignment Details
Target: chr7 (Bit Score: 164; Significance: 1e-87; HSPs: 6)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 33 - 262
Target Start/End: Complemental strand, 5301782 - 5301542
Alignment:
33 tggctggctggctgctttgtccattacttgaccccgttggagtttggtgggaaataccccgcgtgtctttgaagatcctcttttgtccaacccttttttc 132  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5301782 tggctggctggctgctttgtccattacttgaccctgttggagtttggtgggaaataccccgcgtgtctttgaagatcctcttttgtccaacccttttttc 5301683  T
133 atttctttcataaaccaattgtcaaataactcattagcttaattgcac-----------nnnnnnnnnccttctataagaacccaaattattccaccgac 221  Q
    ||||||||||||||| |||||||||||| |||||||||||||||||||                    ||||||||||||||||||||||||||||||||    
5301682 atttctttcataaactaattgtcaaatatctcattagcttaattgcactttttagtttttttttttttccttctataagaacccaaattattccaccgac 5301583  T
222 attaacattagagagactctaatatgagatattgagaggag 262  Q
    |||||||||||||||||||||||||||||||||||||||||    
5301582 attaacattagagagactctaatatgagatattgagaggag 5301542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 27 - 107
Target Start/End: Original strand, 5290528 - 5290607
Alignment:
27 atataatggctggctggctgctttgtccattacttgaccccgttggagtttggtgggaaataccccgcgtgtctttgaaga 107  Q
    |||||||||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||||||| | ||||||||||    
5290528 atataatggctggctggctgctttgtccat-acttgaccctgttggtgtttggtgggaaataccccgcatttctttgaaga 5290607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 33 - 116
Target Start/End: Complemental strand, 5283644 - 5283561
Alignment:
33 tggctggctggctgctttgtccattacttgaccccgttggagtttggtgggaaataccccgcgtgtctttgaagatcctctttt 116  Q
    ||||||| || ||||||||||||| ||||||||  ||||||||||||||||||| ||||||| |||||||||||| ||||||||    
5283644 tggctggatgactgctttgtccatgacttgaccatgttggagtttggtgggaaacaccccgcatgtctttgaagaccctctttt 5283561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 102 - 155
Target Start/End: Complemental strand, 5283544 - 5283491
Alignment:
102 tgaagatcctcttttgtccaacccttttttcatttctttcataaaccaattgtc 155  Q
    |||||| ||||||||||||||||||||| ||| |||||||||||||||||||||    
5283544 tgaagaccctcttttgtccaacccttttgtcaattctttcataaaccaattgtc 5283491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 39 - 104
Target Start/End: Complemental strand, 5309458 - 5309393
Alignment:
39 gctggctgctttgtccattacttgaccccgttggagtttggtgggaaataccccgcgtgtctttga 104  Q
    ||||||||| |||||||| ||||||||| |||||||||||||||||||| ||| || |||||||||    
5309458 gctggctgcgttgtccatgacttgaccctgttggagtttggtgggaaatgcccagcatgtctttga 5309393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 133
Target Start/End: Complemental strand, 5314220 - 5314159
Alignment:
72 gagtttggtgggaaataccccgcgtgtctttgaagatcctcttttgtccaacccttttttca 133  Q
    ||||| ||||||| ||||||||| |||||||||||| |||| || ||| |||| ||||||||    
5314220 gagttaggtgggagataccccgcatgtctttgaagaccctccttggtctaaccattttttca 5314159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University