View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14572_high_50 (Length: 284)
Name: NF14572_high_50
Description: NF14572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14572_high_50 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 1e-87; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 33 - 262
Target Start/End: Complemental strand, 5301782 - 5301542
Alignment:
| Q |
33 |
tggctggctggctgctttgtccattacttgaccccgttggagtttggtgggaaataccccgcgtgtctttgaagatcctcttttgtccaacccttttttc |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5301782 |
tggctggctggctgctttgtccattacttgaccctgttggagtttggtgggaaataccccgcgtgtctttgaagatcctcttttgtccaacccttttttc |
5301683 |
T |
 |
| Q |
133 |
atttctttcataaaccaattgtcaaataactcattagcttaattgcac-----------nnnnnnnnnccttctataagaacccaaattattccaccgac |
221 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5301682 |
atttctttcataaactaattgtcaaatatctcattagcttaattgcactttttagtttttttttttttccttctataagaacccaaattattccaccgac |
5301583 |
T |
 |
| Q |
222 |
attaacattagagagactctaatatgagatattgagaggag |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5301582 |
attaacattagagagactctaatatgagatattgagaggag |
5301542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 27 - 107
Target Start/End: Original strand, 5290528 - 5290607
Alignment:
| Q |
27 |
atataatggctggctggctgctttgtccattacttgaccccgttggagtttggtgggaaataccccgcgtgtctttgaaga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||||||| | |||||||||| |
|
|
| T |
5290528 |
atataatggctggctggctgctttgtccat-acttgaccctgttggtgtttggtgggaaataccccgcatttctttgaaga |
5290607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 33 - 116
Target Start/End: Complemental strand, 5283644 - 5283561
Alignment:
| Q |
33 |
tggctggctggctgctttgtccattacttgaccccgttggagtttggtgggaaataccccgcgtgtctttgaagatcctctttt |
116 |
Q |
| |
|
||||||| || ||||||||||||| |||||||| ||||||||||||||||||| ||||||| |||||||||||| |||||||| |
|
|
| T |
5283644 |
tggctggatgactgctttgtccatgacttgaccatgttggagtttggtgggaaacaccccgcatgtctttgaagaccctctttt |
5283561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 102 - 155
Target Start/End: Complemental strand, 5283544 - 5283491
Alignment:
| Q |
102 |
tgaagatcctcttttgtccaacccttttttcatttctttcataaaccaattgtc |
155 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
5283544 |
tgaagaccctcttttgtccaacccttttgtcaattctttcataaaccaattgtc |
5283491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 39 - 104
Target Start/End: Complemental strand, 5309458 - 5309393
Alignment:
| Q |
39 |
gctggctgctttgtccattacttgaccccgttggagtttggtgggaaataccccgcgtgtctttga |
104 |
Q |
| |
|
||||||||| |||||||| ||||||||| |||||||||||||||||||| ||| || ||||||||| |
|
|
| T |
5309458 |
gctggctgcgttgtccatgacttgaccctgttggagtttggtgggaaatgcccagcatgtctttga |
5309393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 133
Target Start/End: Complemental strand, 5314220 - 5314159
Alignment:
| Q |
72 |
gagtttggtgggaaataccccgcgtgtctttgaagatcctcttttgtccaacccttttttca |
133 |
Q |
| |
|
||||| ||||||| ||||||||| |||||||||||| |||| || ||| |||| |||||||| |
|
|
| T |
5314220 |
gagttaggtgggagataccccgcatgtctttgaagaccctccttggtctaaccattttttca |
5314159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University