View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14572_high_57 (Length: 249)
Name: NF14572_high_57
Description: NF14572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14572_high_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 18 - 180
Target Start/End: Original strand, 5663572 - 5663734
Alignment:
| Q |
18 |
tttgctagacttaaaatttgtatgtttggcattgagtagaatccaaaataggtttattctattgtacttgatttatttctaattgtttttatgctactgt |
117 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||| |||| |||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
5663572 |
tttgctagacttaaaatttttacgtttggcattgagtagaatcaaaaacaggtttattctattgtccttgatttatttctaatggtttttatgctactgt |
5663671 |
T |
 |
| Q |
118 |
tgttgtgattttttatcaatgcagtcaattttcaatagagctgcttctgtatactgttaattg |
180 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
5663672 |
tgttgtcattttttatcaatgcagtcaattttcaatagagctgcttctgtatatttttaattg |
5663734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University