View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14572_high_58 (Length: 242)
Name: NF14572_high_58
Description: NF14572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14572_high_58 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 73 - 151
Target Start/End: Complemental strand, 8343960 - 8343882
Alignment:
| Q |
73 |
gaaacattgtccctattcattcaatctttaatttaataatttactaactttacggataagggggtttccggattgagtc |
151 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8343960 |
gaaacattgtccctgttcattcaatctttaatttaataatttactaactttacggataagggggtttccggattgagtc |
8343882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University