View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14572_high_60 (Length: 240)
Name: NF14572_high_60
Description: NF14572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14572_high_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 212
Target Start/End: Original strand, 32040791 - 32040983
Alignment:
| Q |
20 |
taacccagatgatctaccttttactttggaaaatcacaaaggatacgatgcttctaaatatctttttcagcatcatcaaatattttatgatggtaactcg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32040791 |
taacccagatgatctaccttttactttggaaaatcacaaaggatacaatgcttttaaatatctttttcagcatcatcaaatattttatgatggtaattcg |
32040890 |
T |
 |
| Q |
120 |
agggttaacctatgttcattcttatctcatccataaattttttcagagtttaggtcattcccagagtctattaattcatatgaattaactcga |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| || ||||||||| ||||||||||||||||||||| |
|
|
| T |
32040891 |
agggttaacctatgttcattcttatctcatccacaatttttttcagagtttaggtcataccgagagtctataaattcatatgaattaactcga |
32040983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University