View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14572_low_26 (Length: 438)
Name: NF14572_low_26
Description: NF14572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14572_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 18 - 321
Target Start/End: Complemental strand, 4388272 - 4387972
Alignment:
| Q |
18 |
gaattctggtgggaacaattctttgctaagctttacttaactttcggtagaacttcttaattactaggagcccccttcccctaggaaccggaagcttaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4388272 |
gaattctggtgggaacaattctttgctaagctttacttaactttcggtagaacttcctaattactaggagcccccttcccctaggaaccggaagcttaac |
4388173 |
T |
 |
| Q |
118 |
acacnnnnnnnnnttaaaattcttccgcccaccaaacacttctttgtgttttatgggtgcctcttttgttgatcctatcatctcatcaatgattgtgttg |
217 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4388172 |
aca--aaaaaaaattaaaattcttccgcccaccaaacacttctttgtgtgttatgggtgcctcttt-gttgatcctatcatctcatcaatgattgtgttg |
4388076 |
T |
 |
| Q |
218 |
atttgtgtcgctctgccttcctttgtgactccaatcaaacaatttgttgaatcatggagaaagcaaaacatagtaagccgaggaacaagttctttacaga |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4388075 |
atttgtgtcgctctgccttcctttgtgactccaatcaaacaatttgtttaatcatggagaaagcaaaacatagtaagccgaggaacaagttctttacaga |
4387976 |
T |
 |
| Q |
318 |
agca |
321 |
Q |
| |
|
|||| |
|
|
| T |
4387975 |
agca |
4387972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University