View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14572_low_49 (Length: 301)
Name: NF14572_low_49
Description: NF14572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14572_low_49 |
 |  |
|
| [»] scaffold0200 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0200 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 65 - 299
Target Start/End: Complemental strand, 31114 - 30880
Alignment:
| Q |
65 |
atgtatatttttgttcttgtgcagagctggttgagattttctttgttgacacaaccccttttgttgaagaatacttcactgtaccagaacaccattatga |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31114 |
atgtatatttttgttcttgtgcagagctggttgagattttctttgttgacacaaccccttttgttgaagaatacttcactgtaccagaacaccattatga |
31015 |
T |
 |
| Q |
165 |
ttggaatggagttaacccaccacaaacttatattgccaatttactaaaggtatgaatagattgatttttcacatttaaatttttcttggtatttatatta |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31014 |
ttggaatggagttaacccaccacaaacttatattgccaatttactaaaggtatgaatagattgatttttcacatttaaatttttcttagtatttatatta |
30915 |
T |
 |
| Q |
265 |
tgtagcactgacactttagattaaatatgagtata |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
30914 |
tgtagcactgacactttagattaaatatgagtata |
30880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University