View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14572_low_50 (Length: 299)
Name: NF14572_low_50
Description: NF14572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14572_low_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 18 - 280
Target Start/End: Complemental strand, 6635343 - 6635081
Alignment:
| Q |
18 |
cacaccaacattttggtccaacccatctttgtctttaacattcacgaatcgaaaagcttgttactttaataccggggttatggtaattgatctagaaaaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6635343 |
cacaccaacattttggtccaacccatctttgtctttaacattcgcgaatcgaaaagcttgttactttaataccggggttatggtaattgatctagaaaaa |
6635244 |
T |
|
| Q |
118 |
tggcgcgacggagattacacaacaaagattgaggaatggatggaattacaaaagaggatgagaatctatgaacttggttcattgccaccttttttgcttg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6635243 |
tggcgcgacggagattacacaacaaagattgaggaatggatggaattacaaaagaggatgagaatctatgaacttggttcattgccaccttttttgcttg |
6635144 |
T |
|
| Q |
218 |
tttttgcaggggaaattgttccagtggatcatagatggaatcaacatggtcttggtggtgata |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6635143 |
tttttgcaggggaaattgttccagtggatcatagatggaatcaacatggtcttggtggtgata |
6635081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 140 - 280
Target Start/End: Complemental strand, 52164116 - 52163976
Alignment:
| Q |
140 |
caaagattgaggaatggatggaattacaaaagaggatgagaatctatgaacttggttcattgccaccttttttgcttgtttttgcaggggaaattgttcc |
239 |
Q |
| |
|
||||||||||||| |||||||| || || ||||||||||| ||||||||| | ||||| ||||| || ||||||||||||||||| ||| | |||| ||| |
|
|
| T |
52164116 |
caaagattgaggattggatggagttgcagaagaggatgaggatctatgaattgggttcgttgccgccgtttttgcttgtttttgccgggaatattgctcc |
52164017 |
T |
|
| Q |
240 |
agtggatcatagatggaatcaacatggtcttggtggtgata |
280 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
52164016 |
ggtggatcataggtggaatcaacatggacttggtggtgata |
52163976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 141 - 280
Target Start/End: Complemental strand, 15964453 - 15964314
Alignment:
| Q |
141 |
aaagattgaggaatggatggaattacaaaagaggatgagaatctatgaacttggttcattgccaccttttttgcttgtttttgcaggggaaattgttcca |
240 |
Q |
| |
|
||||||||| | |||||||| |||||||||| || ||||||||||| || |||||||||||||||||||| |||||||||||||| | ||| | |
|
|
| T |
15964453 |
aaagattgaaaactggatggagttacaaaagaagagaagaatctatgagctaggttcattgccaccttttttacttgtttttgcaggaaatgttgaagct |
15964354 |
T |
|
| Q |
241 |
gtggatcatagatggaatcaacatggtcttggtggtgata |
280 |
Q |
| |
|
| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
15964353 |
attgatcatagatggaatcaacatggacttggtggtgata |
15964314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 52 - 280
Target Start/End: Complemental strand, 7266613 - 7266385
Alignment:
| Q |
52 |
ttaacattcacgaatcgaaaagcttgttactttaataccggggttatggtaattgatctagaaaaatggcgcgacggagattacacaacaaagattgagg |
151 |
Q |
| |
|
||||||||| ||| ||| ||||| |||||||| || ||||| |||||||| |||||| ||| ||||| ||||||||| || || |||| || |
|
|
| T |
7266613 |
ttaacattcgcgactcggaaagcgtgttacttcaacaccggagttatggtgattgatttagcgcggtggcggatcggagattatacgacgcagatgacgg |
7266514 |
T |
|
| Q |
152 |
aatggatggaattacaaaagaggatgagaatctatgaacttggttcattgccaccttttttgcttgtttttgcaggggaaattgttccagtggatcatag |
251 |
Q |
| |
|
|||||||||| | || ||||| ||||| |||||||| |||||||||||||| || ||| |||||||||| ||||| |||| ||||| || |||||| | |
|
|
| T |
7266513 |
aatggatggagcttcagaagagaatgaggatctatgagcttggttcattgccgccgtttctgcttgttttcgcaggtaaaatagttccggttgatcatcg |
7266414 |
T |
|
| Q |
252 |
atggaatcaacatggtcttggtggtgata |
280 |
Q |
| |
|
|||||||||||||| ||||| ||||||| |
|
|
| T |
7266413 |
gtggaatcaacatgggcttggcggtgata |
7266385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 247 - 280
Target Start/End: Complemental strand, 2498608 - 2498575
Alignment:
| Q |
247 |
catagatggaatcaacatggtcttggtggtgata |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2498608 |
catagatggaatcaacatggtcttggtggtgata |
2498575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 247 - 280
Target Start/End: Complemental strand, 27101196 - 27101163
Alignment:
| Q |
247 |
catagatggaatcaacatggtcttggtggtgata |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27101196 |
catagatggaatcaacatggtcttggtggtgata |
27101163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 154 - 224
Target Start/End: Original strand, 33346586 - 33346656
Alignment:
| Q |
154 |
tggatggaattacaaaagaggatgagaatctatgaacttggttcattgccaccttttttgcttgtttttgc |
224 |
Q |
| |
|
|||||||| || || ||||| |||||||||||||| |||||||| ||||| || |||||| | |||||||| |
|
|
| T |
33346586 |
tggatggagttgcagaagagaatgagaatctatgagcttggttcgttgccgccgtttttgttggtttttgc |
33346656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University