View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14572_low_64 (Length: 240)
Name: NF14572_low_64
Description: NF14572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14572_low_64 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 37609608 - 37609830
Alignment:
| Q |
1 |
acaaaataaaagctgagtccaacatttattgcccttcccttatttacattgtatgcttatataaatttcatttctaaagaaactatattgtcggtcactc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37609608 |
acaaaataaaagctgagtccaacatttattgcccttcccttatttacattgtatgcttatataaatttcatttctaaagatactatattgtcggtcactc |
37609707 |
T |
 |
| Q |
101 |
gttttcaatattgctataagtcaatataattttgcttttctctctcaaaaaataattttgcttttctnnnnnnncatataggacgagtttcattttgaaa |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37609708 |
gttttcaatattgctataagtca--ataattttgcttttctctctcaaaaaataattttgcttttctaaaaaaaaatataggacgagtttcattttgaaa |
37609805 |
T |
 |
| Q |
201 |
tttatcttaataaatatcattttac |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
37609806 |
tttatcttaataaatatcattttac |
37609830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University