View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14572_low_68 (Length: 237)
Name: NF14572_low_68
Description: NF14572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14572_low_68 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 48605445 - 48605648
Alignment:
| Q |
18 |
aaaagactctcggcaatgccaatcccctttgctgcactgtcttcataacatccgcccaaaaggatgctgcatattttgctgcaacagagaatccttttat |
117 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48605445 |
aaaagactctcggcactgccaatcccctttgctgcactgtcttcataacatctgcccaaaaggatgctgcatattttgctgcaacagagaatccttttat |
48605544 |
T |
|
| Q |
118 |
accaccaaagtgcacaccgtcgtgtaaaccagagtttaggatcacagtgtccgggactgtatcttctgagaagtattccttcaacaaattttgatacctt |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48605545 |
accaccaaagtgtacaccgtcgtgtaaaccagagtttaggatcacagtgtccgggactgtatcttctgagaagtattccttcaacaaattttgatacctt |
48605644 |
T |
|
| Q |
218 |
tcat |
221 |
Q |
| |
|
|||| |
|
|
| T |
48605645 |
tcat |
48605648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 48611041 - 48611234
Alignment:
| Q |
18 |
aaaagactctcggcaatgccaatcccctttgctgcactgtcttcataacatccgcccaaaaggatgctgcatattttgctgcaacagagaatccttttat |
117 |
Q |
| |
|
|||| ||||| |||| |||||||||||||||| |||||||||||||||||| |||||||| ||||||||||| | |||| | ||||||||| || ||| |
|
|
| T |
48611041 |
aaaacactcttggcagtgccaatcccctttgcctcactgtcttcataacatctgcccaaaaagatgctgcatagtctgctcccacagagaatgctcgtat |
48611140 |
T |
|
| Q |
118 |
accaccaaagtgcacaccgtcgtgtaaaccagagtttaggatcacagtgtccgggactgtatcttctgagaagtattccttcaacaaattttga |
211 |
Q |
| |
|
|| || |||||| |||||||| || || |||||||| | |||||||||||| || ||||| |||||||||||||||| ||||||||| |||||| |
|
|
| T |
48611141 |
actacgaaagtggacaccgtcatgcaagccagagttcatgatcacagtgtctggtactgtgtcttctgagaagtatttcttcaacaagttttga |
48611234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University