View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14572_low_70 (Length: 237)
Name: NF14572_low_70
Description: NF14572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14572_low_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 103 - 210
Target Start/End: Complemental strand, 47617086 - 47616979
Alignment:
| Q |
103 |
acaaaacactataattcaaatccatcatttcccttaatttcttcttttaaggtactatagaaacaacatttagtatatcaaacatgatgctacactacaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47617086 |
acaaaacactataattcaaatccatcatttcccttaatttcttcttttaaggtactatagaaacaacatttagtatatcaaacatgatgctacactacaa |
47616987 |
T |
 |
| Q |
203 |
tgctattt |
210 |
Q |
| |
|
|||||||| |
|
|
| T |
47616986 |
tgctattt |
47616979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University