View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14572_low_73 (Length: 234)
Name: NF14572_low_73
Description: NF14572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14572_low_73 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 3 - 217
Target Start/End: Complemental strand, 43119008 - 43118794
Alignment:
| Q |
3 |
atatgtgaattataataagttataagcacgtcatgtatgggttaaacatatctttttatccttgatataagcaaggtttgtcaataaccctacacaacca |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43119008 |
atatgtgaattataataagttataagcacgtcatgaaagggttaaacatatctttttatccttgatataagcaaggtttgtcaataaccctgcacaacca |
43118909 |
T |
 |
| Q |
103 |
gcttattcctaacttcgattttcacctttgaactaccccattttcatattgcaagtaaagaagatattgaatgtgtaagctcttgaatcgaagcatgaat |
202 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43118908 |
gcttattcctaacttcgaatttcacctttgaactaccccattttcatattgcaagtaaagaagatattgaatgtgtaagctcttgaatcaaagcatgaat |
43118809 |
T |
 |
| Q |
203 |
aaatatgttatgagt |
217 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43118808 |
aaatatgttatgagt |
43118794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University