View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14572_low_76 (Length: 227)
Name: NF14572_low_76
Description: NF14572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14572_low_76 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 5 - 227
Target Start/End: Original strand, 28977579 - 28977801
Alignment:
| Q |
5 |
cactagggtcattccacctatcagaactgaaaagcttggtaagaatgggaatgttacagcaataaaaaatgtgaaccctccaaagaataagcgaaagcat |
104 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28977579 |
cactagggtcattccacctatcagagctgaaaggcttggtaagaatgggaatgttacagcaataaaaaatgtgaaccctccaaagaataagcgaaagcat |
28977678 |
T |
 |
| Q |
105 |
gttctcaaccatcttggacatttttgattctttatggttgtgtatcttagctccaagttgtcaaatacaggcattgcatagacttggaagctagttaaac |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28977679 |
gttctcaaccatcttggacatttttgattttttatgactgtgtatcttagctccaagttgtcaaatacaggcattgcatagacttggaagctagttaaac |
28977778 |
T |
 |
| Q |
205 |
aatgtagtatcacccaaacataa |
227 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28977779 |
aatgtagtatcacccaaacataa |
28977801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University