View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14572_low_77 (Length: 223)
Name: NF14572_low_77
Description: NF14572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14572_low_77 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 26959086 - 26958880
Alignment:
| Q |
1 |
tatcaaagtttattctttttgactatgtgatgtttttaagaaatataccattgattgaaatttgtgacaagttttttctattttggtgttgtggaattgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26959086 |
tatcaaagtttattctttttgactatgtgatgtttttaagaaatatatcattgattgaaatttgtgacaagttttttctattttggtgttgtggaattgg |
26958987 |
T |
|
| Q |
101 |
ttttaggtatgataatgggggcatcagcatcatcagtttggtataatttgagagtggctcatccaacaaaacaagtgccaatattagactatgatttggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26958986 |
ttttaggtatgataatgggggcatcagcatcatcagtttggtataatttgagagtggctcatccaacaaaacaagtgccaatattagactatgatttggc |
26958887 |
T |
|
| Q |
201 |
tcttttg |
207 |
Q |
| |
|
||||||| |
|
|
| T |
26958886 |
tcttttg |
26958880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University