View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14572_low_77 (Length: 223)

Name: NF14572_low_77
Description: NF14572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14572_low_77
NF14572_low_77
[»] chr1 (1 HSPs)
chr1 (1-207)||(26958880-26959086)


Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 26959086 - 26958880
Alignment:
1 tatcaaagtttattctttttgactatgtgatgtttttaagaaatataccattgattgaaatttgtgacaagttttttctattttggtgttgtggaattgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
26959086 tatcaaagtttattctttttgactatgtgatgtttttaagaaatatatcattgattgaaatttgtgacaagttttttctattttggtgttgtggaattgg 26958987  T
101 ttttaggtatgataatgggggcatcagcatcatcagtttggtataatttgagagtggctcatccaacaaaacaagtgccaatattagactatgatttggc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26958986 ttttaggtatgataatgggggcatcagcatcatcagtttggtataatttgagagtggctcatccaacaaaacaagtgccaatattagactatgatttggc 26958887  T
201 tcttttg 207  Q
    |||||||    
26958886 tcttttg 26958880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University