View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14572_low_79 (Length: 210)
Name: NF14572_low_79
Description: NF14572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14572_low_79 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 28977781 - 28977981
Alignment:
| Q |
1 |
tgtagtatcacccaaacataaagtgcgccaatcgagaattttgttgcttgttctttgtggaattgtgggaacgcagttaacaatcctttttcaggtatct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28977781 |
tgtagtatcacccaaacataaagtgcgccaatcgagaattttgttgcttgttctttgtggaattgtgggaacgcagttaacaatcctttatcaggtatct |
28977880 |
T |
|
| Q |
101 |
gaaagcaacatgaatacacacgattaaatattatgtagggtttcatttataaataaaattatattgtccgttaatcttaatcgtcaatttacacatgaat |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28977881 |
gaaagcaacatgaatacagacgattaaatattatttagggtttcatttataaataaaattatattgtctgttaatcttaatcgtcaatttacacatgaat |
28977980 |
T |
|
| Q |
201 |
a |
201 |
Q |
| |
|
| |
|
|
| T |
28977981 |
a |
28977981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University