View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14572_low_9 (Length: 586)
Name: NF14572_low_9
Description: NF14572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14572_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 265; Significance: 1e-147; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 265; E-Value: 1e-147
Query Start/End: Original strand, 20 - 292
Target Start/End: Complemental strand, 41748172 - 41747900
Alignment:
| Q |
20 |
gcagaaacaacgcattcatcgctgctggagtttataacaaccttctttgtcgtgggttgaatgaaattcgtaagcgcgtctgcaccacgtatttcaatgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41748172 |
gcagaaacaacgcattcatcgctgctggagtttataacaaccttctttgtcgtgggttgaatgaaattcgtaagcgcgtctgcaccacgtatttcaatgg |
41748073 |
T |
|
| Q |
120 |
cggctttatcatactccatagcagcttcttcagcagtgttgtaagttcccaaccaccgtcgaaatttgagtttggggtctcttatctccgccgcccattt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41748072 |
cggctttatcatactccatagcagcttcttcagcagtgttgtaagttcccaaccaccgtcgaaatttgagtttggggtctcttatctccgccgcccattt |
41747973 |
T |
|
| Q |
220 |
tccccaaggtctttgtctcactccacgatatttcttcccggtgcaaatcaccggccgccgttgagtcgccgga |
292 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41747972 |
tccccaaggtctctgtctcactccacgatatttcttcccggtgtaaatcaccggccgccgttgagtcgccgga |
41747900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 193; E-Value: 1e-104
Query Start/End: Original strand, 351 - 567
Target Start/End: Complemental strand, 41747841 - 41747625
Alignment:
| Q |
351 |
cgatcacaatgtcgtggatgaaagttttgattctgcagcgaggggtaaaattggaatgtgttggattttcttcttcgtcagaagaagaatccgtggcgtc |
450 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41747841 |
cgatcacaatgtcgtggatgaaagttttgattctgcggcgaggggtaatattggaatgtattggattttcttcttcgtcagaagaagaatccgtggcgtc |
41747742 |
T |
|
| Q |
451 |
agggtcggtgtaacgtatttgtatagtttttggcatgatgttgttgatttgtgtgaagtgatgagtgtgtttgatgatgttaggaataggaggaggtgta |
550 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
41747741 |
agggtcggtgtaacgtatttgtatagtttttggcatgatgttgttgatttgtgtgaagtgatgagtgtgtttgatgatgttgggaatgggaggaggtgta |
41747642 |
T |
|
| Q |
551 |
gaaggttgtttaggcat |
567 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
41747641 |
gaaggttgtttgggcat |
41747625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 142 - 174
Target Start/End: Complemental strand, 8585005 - 8584973
Alignment:
| Q |
142 |
agcttcttcagcagtgttgtaagttcccaacca |
174 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
8585005 |
agcttcttcagcactgttgtaagttcccaacca |
8584973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 194 - 256
Target Start/End: Original strand, 2361307 - 2361369
Alignment:
| Q |
194 |
gggtctcttatctccgccgcccattttccccaaggtctttgtctcactccacgatatttcttc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| || ||||||||||| ||||||||| |
|
|
| T |
2361307 |
gggtctcttatctccgccgcccattttccccatggtctctgcctcactccacggtatttcttc |
2361369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 197 - 243
Target Start/End: Complemental strand, 13409927 - 13409881
Alignment:
| Q |
197 |
tctcttatctccgccgcccattttccccaaggtctttgtctcactcc |
243 |
Q |
| |
|
|||||||| || || |||||||||||||| ||||||||||||||||| |
|
|
| T |
13409927 |
tctcttatttctgctgcccattttccccatggtctttgtctcactcc |
13409881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University