View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14573_high_15 (Length: 227)
Name: NF14573_high_15
Description: NF14573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14573_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 70 - 222
Target Start/End: Original strand, 9535108 - 9535261
Alignment:
| Q |
70 |
agcatgaaaactcatatgttgcaacaaactcatattgacaaatatttaggcttctcaattcttaaagggagagcgaagaggaatgatttttattttatta |
169 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
9535108 |
agcatcaaaactcatatgttgcaacaaactcatattgacaaatatttaggcttctcaattcttaatgggagagcgaagaggaatgatttttattttatta |
9535207 |
T |
 |
| Q |
170 |
ttgagataatgcaactcagactcgctttttgg-atattagattgctaaacaaac |
222 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| | | ||||||||||||||||| |
|
|
| T |
9535208 |
ttgagataatgcaattcagactcgctttttggaagaatagattgctaaacaaac |
9535261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 142 - 183
Target Start/End: Complemental strand, 35062789 - 35062748
Alignment:
| Q |
142 |
gcgaagaggaatgatttttattttattattgagataatgcaa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35062789 |
gcgaagaggaatgatttttattttattattgagaaaatgcaa |
35062748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 112 - 183
Target Start/End: Complemental strand, 1353495 - 1353424
Alignment:
| Q |
112 |
tatttaggcttctcaattcttaaagggagagcgaagaggaatgatttttattttattattgagataatgcaa |
183 |
Q |
| |
|
|||||||||||||| ||||| ||||| || | ||| |||||| |||| |||||||||||||||| ||||||| |
|
|
| T |
1353495 |
tatttaggcttctctattctgaaaggaagggtgaaaaggaataatttctattttattattgagaaaatgcaa |
1353424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University