View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14573_low_16 (Length: 234)
Name: NF14573_low_16
Description: NF14573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14573_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 5540296 - 5540524
Alignment:
| Q |
1 |
ttttttgtttcttacatttgagacaagagggagtataaatttagttagtcgaattatccactgtgacaccaaacataagcttagtcagtcactaaggaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
5540296 |
ttttttgtttcttacatttgagacaagaggaagtataagtttagttagtcgaattatccactgtgacaccaaacataagctttgtcagtcactgaggaag |
5540395 |
T |
|
| Q |
101 |
taacaacg--cggcatgcacctatcagctgatctttctttccccttg---nnnnnnnnnnnnnttcaatattctgtaatagttcttagttcgtacatagc |
195 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5540396 |
taacaacgcacggcatgcacctatcagctgatctttctttccccttgaaaaaaaaataaaaaattcaatattctgtcatagttcttagttcgtacatagc |
5540495 |
T |
|
| Q |
196 |
aaattgtcaatccctttccttcatctcac |
224 |
Q |
| |
|
|||||||||||||||||||||||| |||| |
|
|
| T |
5540496 |
aaattgtcaatccctttccttcatttcac |
5540524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 647783 - 647747
Alignment:
| Q |
1 |
ttttttgtttcttacatttgagacaagagggagtata |
37 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
647783 |
ttttttgtttcttacatttgagaccagagggagtata |
647747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 12314336 - 12314371
Alignment:
| Q |
1 |
ttttttgtttcttacatttgagacaagagggagtat |
36 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12314336 |
ttttttgtttcttacatttgagaccagagggagtat |
12314371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 28164794 - 28164758
Alignment:
| Q |
1 |
ttttttgtttcttacatttgagacaagagggagtata |
37 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28164794 |
ttttttgtttcttacatttgagaccggagggagtata |
28164758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University