View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14573_low_17 (Length: 227)

Name: NF14573_low_17
Description: NF14573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14573_low_17
NF14573_low_17
[»] chr4 (1 HSPs)
chr4 (70-222)||(9535108-9535261)
[»] chr2 (1 HSPs)
chr2 (142-183)||(35062748-35062789)
[»] chr7 (1 HSPs)
chr7 (112-183)||(1353424-1353495)


Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 70 - 222
Target Start/End: Original strand, 9535108 - 9535261
Alignment:
70 agcatgaaaactcatatgttgcaacaaactcatattgacaaatatttaggcttctcaattcttaaagggagagcgaagaggaatgatttttattttatta 169  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
9535108 agcatcaaaactcatatgttgcaacaaactcatattgacaaatatttaggcttctcaattcttaatgggagagcgaagaggaatgatttttattttatta 9535207  T
170 ttgagataatgcaactcagactcgctttttgg-atattagattgctaaacaaac 222  Q
    |||||||||||||| ||||||||||||||||| | | |||||||||||||||||    
9535208 ttgagataatgcaattcagactcgctttttggaagaatagattgctaaacaaac 9535261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 142 - 183
Target Start/End: Complemental strand, 35062789 - 35062748
Alignment:
142 gcgaagaggaatgatttttattttattattgagataatgcaa 183  Q
    |||||||||||||||||||||||||||||||||| |||||||    
35062789 gcgaagaggaatgatttttattttattattgagaaaatgcaa 35062748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 112 - 183
Target Start/End: Complemental strand, 1353495 - 1353424
Alignment:
112 tatttaggcttctcaattcttaaagggagagcgaagaggaatgatttttattttattattgagataatgcaa 183  Q
    |||||||||||||| ||||| ||||| || | ||| |||||| |||| |||||||||||||||| |||||||    
1353495 tatttaggcttctctattctgaaaggaagggtgaaaaggaataatttctattttattattgagaaaatgcaa 1353424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University