View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14574_high_8 (Length: 204)
Name: NF14574_high_8
Description: NF14574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14574_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 15 - 186
Target Start/End: Complemental strand, 22456267 - 22456096
Alignment:
| Q |
15 |
agaaaatctattttaaaaatgtgacaacatattgacaagaatagtgttaaagtcgtgagtactccattggtgaatcacttattaagctcttattgaggca |
114 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22456267 |
agaaaatctattttgaaaatgtgacaacatattgacaagaataatgttaaagtcgtgagtactccattggtgaatcacttattaagctcttattgaggca |
22456168 |
T |
 |
| Q |
115 |
gtgtttaaacatagattcacaagtttagtatatgtcaaaggttccttatttcaatgttacagactgtttaat |
186 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22456167 |
gtgtttaaacatagatacaaaagtttagtatatgtcaaaggttccttatttcaatgttacagattgtttaat |
22456096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 125 - 173
Target Start/End: Complemental strand, 33559685 - 33559637
Alignment:
| Q |
125 |
atagattcacaagtttagtatatgtcaaaggttccttatttcaatgtta |
173 |
Q |
| |
|
|||||| || ||||| ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
33559685 |
atagatgcagaagttaagtatatgtcaaaggttccttatgtcagtgtta |
33559637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University