View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14574_low_3 (Length: 405)
Name: NF14574_low_3
Description: NF14574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14574_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 1e-54; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 11 - 127
Target Start/End: Original strand, 40511024 - 40511140
Alignment:
| Q |
11 |
cagagaaaagttgatcaatttgtggtttcctaattcatcaagacaaagtatgaccctacctttgatctcaggttgccgttagggctggtgcactcagtga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40511024 |
cagagaaaagttgatcaatttgtggtttccaaattcatcaagacaaagtatgaccctacctttgatctcaggttgccgttagggctggtgcacgcagtga |
40511123 |
T |
|
| Q |
111 |
atggcatgtaacaaatg |
127 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40511124 |
atggcatgtaacaaatg |
40511140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 192 - 284
Target Start/End: Original strand, 40511205 - 40511298
Alignment:
| Q |
192 |
agctgattagttttataggatctgatgtattaaaa-tcagtcaagagaccaaaccaatgagatcagaataagcttaattggttcaattgatggc |
284 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40511205 |
agctgattagttttataggatctgatttattaaaaatcagtcaagagaccaaaccaatgagaccagaataagcttaattggttcaattgatggc |
40511298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 330 - 373
Target Start/End: Original strand, 40511345 - 40511388
Alignment:
| Q |
330 |
ttagtccctgttcaaccggatcaactgtgaattaaccagtttcc |
373 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
40511345 |
ttagtccctattcaactggatcaactgtgaattaaccagtttcc |
40511388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University