View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14574_low_6 (Length: 309)
Name: NF14574_low_6
Description: NF14574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14574_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 5 - 254
Target Start/End: Original strand, 52794122 - 52794369
Alignment:
| Q |
5 |
gagagatgaaatacgatttgtttttagaaacaannnnnnnatcggtatttatagaaatgatttgattttgttgatgaatcaaacgcgtggtaattaatgg |
104 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||| |||||| |||||||||||||||||||||||||||||||||||| || |
|
|
| T |
52794122 |
gagagatgaaatacgatttgtttatagaaacaatttttttatcggtatttctagaaaggatttgattttgttgatgaatcaaacgcgtggtaata---gg |
52794218 |
T |
 |
| Q |
105 |
cttacttgtacaataccattttatatgtggtactttactgattattgaatgatttgcttaaattagagatgcagtaccattc-nnnnnnnggaaatgaat |
203 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
52794219 |
cttacttgtgcaataccattttatatgtggtactttactgattattgaatgatttgcttaaattagagatgcagtaccattctttttattggaaatgaat |
52794318 |
T |
 |
| Q |
204 |
tgattttgttcataatacaaacgcgtccgattttgcattcactgcatacat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52794319 |
tgattttgttcataatacaaacgcgtccgattttgcattcactgcatacat |
52794369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University