View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14575_low_19 (Length: 256)
Name: NF14575_low_19
Description: NF14575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14575_low_19 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 20543560 - 20543297
Alignment:
| Q |
1 |
tatgaactctctctcctttgtgatgctgaggttgctctcattattttctctagccgtggaaaactctatgagttctgcagtggaactaggtaaatgaat- |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
20543560 |
tatgaactctctctcctttgtgatgctgaggttgctctcattattttctctagccgtggaaaactctatgagttttgcagtggaactaggtacatgaatc |
20543461 |
T |
|
| Q |
100 |
-----tattannnnnnn--aattattctcttgtgtgacaaatctttgaaactaattatttgtggatctttttctcttgatgcttgagttgtttaattaat |
192 |
Q |
| |
|
| ||| |||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20543460 |
tttttttttattttttattaattattctcttgtgtgaaaaatctttgaaaccaattatttgtggatctttttctcttgatgcttgagttgtttaattaat |
20543361 |
T |
|
| Q |
193 |
tgcttaaagattataacttgttggtgaaaaatttgtgcacatatttttcatcatgatatttttt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20543360 |
tgcttaaagattataacttgttggtgaaaaatttgtgcacatatttttcatcatgatatttttt |
20543297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 12811995 - 12811925
Alignment:
| Q |
1 |
tatgaactctctctcctttgtgatgctgaggttgctctcattattttctctagccgtggaaaactctatga |
71 |
Q |
| |
|
|||||||| ||| | || ||||||||||| ||||| || || ||||||||||||||||| ||||||||||| |
|
|
| T |
12811995 |
tatgaactgtctgttctctgtgatgctgaagttgcccttatcattttctctagccgtggcaaactctatga |
12811925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 34830957 - 34830884
Alignment:
| Q |
1 |
tatgaactctctctcctttgtgatgctgaggttgctctcattattttctctagccgtggaaaactctatgagtt |
74 |
Q |
| |
|
|||||||| ||| | |||||||||||||| |||||||| || || ||||| | | | ||||||||||||||||| |
|
|
| T |
34830957 |
tatgaactttctgttctttgtgatgctgaagttgctcttatcatcttctccaacagaggaaaactctatgagtt |
34830884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 45690365 - 45690401
Alignment:
| Q |
16 |
ctttgtgatgctgaggttgctctcattattttctcta |
52 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45690365 |
ctttgtgatgctgaagttgctctcattattttctcta |
45690401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University