View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14575_low_20 (Length: 253)
Name: NF14575_low_20
Description: NF14575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14575_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 12 - 169
Target Start/End: Complemental strand, 26929675 - 26929519
Alignment:
| Q |
12 |
gagaagaagaaagatgcttatggtgaggattgagaaacaaaaatggaaaggaaaagaggattatggaaaaggaagccaagacatcctttcatatatatga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26929675 |
gagaagaagaaagatgcttatggtgaggattgagaaacaaaaatg-aaaggaaaagaggattatggaaaaggaagccaagacatcctttcatatatatga |
26929577 |
T |
 |
| Q |
112 |
ccactaatagacactacatgcatccagcgataaaatagtaaagtctggtaactatata |
169 |
Q |
| |
|
||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26929576 |
ccagtaatatacactacatgcatccagcgataaaatagtaaagtctggtaactatata |
26929519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University