View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14575_low_23 (Length: 241)
Name: NF14575_low_23
Description: NF14575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14575_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 11 - 223
Target Start/End: Original strand, 47583495 - 47583707
Alignment:
| Q |
11 |
tcttcagatcatagttcaattgattaaatcatgatttttagtttcttattcagatgaattgatatgtagttgaatgtaaatgtgatgatgcaggtgacaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47583495 |
tcttcagatcatagttcaattgattaaatcatgatttttagtttcttattccgatgaattgatatgtagttgaatgtaaatgtgatgatgcaggtgacaa |
47583594 |
T |
|
| Q |
111 |
attcagggacaggagcacaggaaacagtgagaattgtagatcaatgcagcaatggagggttggatttggatgtgggagtgtttaacagaatcgacacaga |
210 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47583595 |
attcaggtacaggagcacaggaaacagtgagaattgtagatcaatgcagcaatggagggttggatttggatgtgggagtgtttaacagaatcgacacaga |
47583694 |
T |
|
| Q |
211 |
tggcagaggatac |
223 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47583695 |
tggcagaggatac |
47583707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University