View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14576_high_7 (Length: 362)
Name: NF14576_high_7
Description: NF14576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14576_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 11 - 268
Target Start/End: Complemental strand, 3640327 - 3640070
Alignment:
| Q |
11 |
cacagactgggcaccatgacgggcgtcatggctcatgacggtctgtccatcatggtcttgaagcacgcgctctagcctttgttctggctggcttacgctc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3640327 |
cacagactgggcaccatgacgggcgtcacggctcatgacggtctgtccatcatggtcttcaagcacgcgctctagcctttgttctggctggcttacgctc |
3640228 |
T |
|
| Q |
111 |
agttgcagaggagggtgtgacaggtgtggctgaacctactgactagaaattcacctttggggtgttcggggttcgagcccctacatggacttatgcataa |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3640227 |
agttgcagaggagggtatgacaggtgtggctgaacctactgactagaaattcacctttggagtgttcagggttcgagcccctacatggacttatgcataa |
3640128 |
T |
|
| Q |
211 |
gaggagagcagcttagtttccatcttttgctcttccaacagtaccacaggcaactctt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3640127 |
gaggagagcagcttagtttccatcttttgctcttccaacagtaccacaggcaactctt |
3640070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 41153976 - 41153936
Alignment:
| Q |
14 |
agactgggcaccatgacgggcgtcatggctcatgacggtct |
54 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
41153976 |
agactgggcaccatgacgggcgtcatggatgatgacggtct |
41153936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University