View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14577_high_13 (Length: 240)
Name: NF14577_high_13
Description: NF14577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14577_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 4 - 224
Target Start/End: Complemental strand, 26888980 - 26888760
Alignment:
| Q |
4 |
tgaagccttaatgtgagaaggttagttaaacgggagatttcgttaggaatatctccggcaaggttgttgtcggagaggtcaagacggaggaggttgttta |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26888980 |
tgaagccttaatgtgagaaggttagttaaacgggagatttcgttaggaatatctccagcgaggttgttgtcggagaggtcaagacggaggaggttgttta |
26888881 |
T |
 |
| Q |
104 |
gggaggagatttccggtgggatttggccggaaaagtcgtttccggcaaggtagaggagtttgaggtttgtgcagttggataggagagacgctgaaacagt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26888880 |
gggaggagatttccggtgggatttggccggaaaagtcgtttccggcaaggtagaggagtttgaggtttgtgcagttggataggagagacgctgaaacagt |
26888781 |
T |
 |
| Q |
204 |
gccattgaggcggttgttatg |
224 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
26888780 |
gccattcaggcggttgttatg |
26888760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University