View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14577_high_7 (Length: 347)
Name: NF14577_high_7
Description: NF14577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14577_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 300; Significance: 1e-169; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 19 - 330
Target Start/End: Complemental strand, 40902902 - 40902591
Alignment:
| Q |
19 |
cacagagcagaatataaacggtatttaactgagaaaccgatgtaatcttccgtacttaaacgtaaccgagaagccaatgtaatcttccgtatttaaacgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
40902902 |
cacagagcagaatataaacggtatttaactgagaaaccgatgtaatcttccgtacttaaacgtaactgagaaaccaatgtaatcttccgtatttaaacgt |
40902803 |
T |
|
| Q |
119 |
atgtgtcacgccttcctgcagctgcactgtaggcagggcaatgaccagttcaacagcaggctgattttcttcatggttcagatttggactccaactccat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40902802 |
atgtgtcacgccttcctgcagctgcactgtaggcagggcaatgaccagttcaacagcaggctgattttcttcatggttcagatttcgactccaactccat |
40902703 |
T |
|
| Q |
219 |
ttccagttctgcacaccatcggatgcagacagtttctgtgctactatgaattgcttgtcagaagctaaactgaacgggtatggaaattgatgacagattg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40902702 |
ttccagttctgcacaccatcggatgcagacagtttctgtgctactatgaattgcttgtcagaagctaaactgaacgggtatggaaattgatgacagattg |
40902603 |
T |
|
| Q |
319 |
gctgatccactt |
330 |
Q |
| |
|
|||||||||||| |
|
|
| T |
40902602 |
gctgatccactt |
40902591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 174 - 307
Target Start/End: Complemental strand, 30149676 - 30149543
Alignment:
| Q |
174 |
gcaggctgattttcttcatggttcagatttggactccaactccatttccagttctgcacaccatcggatgcagacagtttctgtgctactatgaattgct |
273 |
Q |
| |
|
|||||| |||||| |||||||||||||||| |||||||||| ||||||||||||||||||||||||| || ||||||||||||||||| |||||| || |
|
|
| T |
30149676 |
gcaggcagattttgttcatggttcagatttcgactccaacttcatttccagttctgcacaccatcggtctcatacagtttctgtgctactgtgaattcct |
30149577 |
T |
|
| Q |
274 |
tgtcagaagctaaactgaacgggtatggaaattg |
307 |
Q |
| |
|
||||||||||||||| |||| ||| ||||||||| |
|
|
| T |
30149576 |
tgtcagaagctaaacagaacaggtttggaaattg |
30149543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University