View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14577_low_10 (Length: 319)
Name: NF14577_low_10
Description: NF14577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14577_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 40 - 289
Target Start/End: Complemental strand, 22326449 - 22326200
Alignment:
| Q |
40 |
atctgttgctgaatactatgcgaatctgcgactatatgatctatttatataacattctttagtgtttttattctatgtttttgtaaaactaaacactgtt |
139 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22326449 |
atctgttgctgaattctatgcgaatctgcgactatatgatctatttatataacattctttagtgtttttattcaatgtttttgtaaaactaaacactgtt |
22326350 |
T |
 |
| Q |
140 |
ttttgtatttctttagagaaagaactggaaagaaaaacaatggcctatcttgtcaaatctgtgggttacgttgctcaatggaaattgaatgtcaacaact |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22326349 |
ttttgtatttctttagagaaagaactggaaagaaaaacaatggcctatcttgtcaaatcagtgggttaccttgctcaatggaaattgaatgtcaacaact |
22326250 |
T |
 |
| Q |
240 |
tggatcagaatgaacccaaacacatatccaatacattcaaaattgatatg |
289 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
22326249 |
tggatcagaatgaacccaaacacatatccgatacattcaaaattgatatg |
22326200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University