View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14577_low_12 (Length: 270)
Name: NF14577_low_12
Description: NF14577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14577_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 21 - 251
Target Start/End: Original strand, 48357364 - 48357594
Alignment:
| Q |
21 |
aatgggtgcatgtcttgaccctcctaatcatgcttgggttgttactgaatatctaagcaccacacttaaggagtggctttatggtcctggcaaaagacgc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48357364 |
aatgggtgcatgtcttgaccctcctaatcatgcttgggtggttactgaatatctaagcaccacacttaaggagtggctttatggtcctggcaaaagacgc |
48357463 |
T |
 |
| Q |
121 |
agagatagaattgtgccacttcctcctttcaaagaaagactaacaagggtcatagagatagcccaagctatgcagtatcttcatgagcaaaagcccaaaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48357464 |
agagatagaattgtgccacttcctcctttcaaagaaagactaacaagggtcatagagatagcccaagctatgcagtatcttcatgagcaaaagcccaaaa |
48357563 |
T |
 |
| Q |
221 |
ttattcaccgtgacttgaagcccagcaacat |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
48357564 |
ttattcaccgtgacttgaagcccagcaacat |
48357594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University