View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14577_low_14 (Length: 243)
Name: NF14577_low_14
Description: NF14577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14577_low_14 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 131 - 243
Target Start/End: Original strand, 38622875 - 38622988
Alignment:
| Q |
131 |
ttttggtttggtaactcctcgtacccacc-actcccatcaggcttcttgtttattcccccactcacttacacgctgaaacaagtagtaacaacaaaacaa |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38622875 |
ttttggtttggtaactcctcgtacccacccactcccatcaggcttcttgtttattcccccactcacttacacgctgaaacaagtagtaacaacaaaacaa |
38622974 |
T |
|
| Q |
230 |
ctccattaataacc |
243 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
38622975 |
ctccattaataacc |
38622988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 96 - 139
Target Start/End: Original strand, 38622825 - 38622868
Alignment:
| Q |
96 |
ccattaattgtgacattattattaagttagattagttttggttt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38622825 |
ccattaattgtgacattattattaagttagattagttttggttt |
38622868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University