View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14577_low_9 (Length: 342)
Name: NF14577_low_9
Description: NF14577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14577_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 168 - 326
Target Start/End: Original strand, 3123371 - 3123526
Alignment:
| Q |
168 |
tcaactacaactgtatttatcatctacatcttcaagaatccttatttttgattcctatctatctaccacgtgcgagaccttcaacaaaggagtcttgcta |
267 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||| |||| | ||||||||| |||| ||| | ||||||||||||||||||||||||||| |
|
|
| T |
3123371 |
tcaactacaactatatttatcatttacatcttcaagaatcattatgtctgattcctac---tctatcacatttgagaccttcaacaaaggagtcttgcta |
3123467 |
T |
 |
| Q |
268 |
tttgatagaagtggaactctacctatgtcaaactcatcgttcgattcttctttggattt |
326 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3123468 |
tttgatggaagtggaactctacctatgtcaaactcatcattcgattcttctttggattt |
3123526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University