View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14578_high_10 (Length: 249)
Name: NF14578_high_10
Description: NF14578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14578_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 29894434 - 29894276
Alignment:
| Q |
1 |
cttgtcatcgttgcagtcacggtgttctgaactgagctcttgacctacttttcaattaaacacnnnnnnncttcatataggtgagataacaaacttgcga |
100 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
29894434 |
cttgtcatccttgcagtcactgtgttctgaacggagctcttgacctacttttcaattaaacacttttttacttcatataggtgagataac-aacttgcga |
29894336 |
T |
|
| Q |
101 |
gagnnnnnnnnccaaaataagcta-actaccgtcacaacataatcacttgtgagaggttttt |
161 |
Q |
| |
|
||| ||||||||||||| ||||| ||||||||| ||||||| ||||||| ||||| |
|
|
| T |
29894335 |
gag--ttttttccaaaataagctatactacggtcacaacagaatcactcgtgagagtttttt |
29894276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University