View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14578_low_14 (Length: 267)
Name: NF14578_low_14
Description: NF14578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14578_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 25 - 250
Target Start/End: Complemental strand, 7210003 - 7209778
Alignment:
| Q |
25 |
acactattttgcacactaggactcatagtcaaattaagagattgaaaaccatttccatcactagaagttgttttcccctcagaagaaaactgagtttgag |
124 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7210003 |
acaccattttgcacacaaggactcatagtcaaattaagagattgaaaaccatttccatcactagaagttgttttcccctcagaagaaaactgagtttgag |
7209904 |
T |
 |
| Q |
125 |
tcatccaagatttatacatgctattatcatggattaaagcatgatgattgttgttgctgtgatcattatatgcatgaaaagagtgaatcaaagattggtt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7209903 |
tcatccaagatttatacatgctattatcatggattaaagcatgatgattgttgttgctgtgatcattatatgcatgaaaagagtgaatcaaagattggtt |
7209804 |
T |
 |
| Q |
225 |
tgttagattcttccttgtgtcaatct |
250 |
Q |
| |
|
||||||||||| |||||||||||||| |
|
|
| T |
7209803 |
tgttagattctcccttgtgtcaatct |
7209778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University