View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14579_high_16 (Length: 350)
Name: NF14579_high_16
Description: NF14579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14579_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 4e-75; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 190 - 336
Target Start/End: Complemental strand, 35922485 - 35922339
Alignment:
| Q |
190 |
ccaactatatttgttgatgtgcaaagattggagttgctgcatctattggagccaaatttggaattgatggaaaccctggtgagttaccaaagtggtatgc |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35922485 |
ccaactatatttgttgatgtgcaaagattggagttgctgcatctattggagccaaatttggaattgatggaaaccctggtgagttaccaaagtggtatgc |
35922386 |
T |
 |
| Q |
290 |
aattgttgtggtgctattcatttgcgcttatgtagcagcatattctt |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35922385 |
aattgttgtggtgctattcatttgcgcttatgtagcagcattttctt |
35922339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 18 - 123
Target Start/End: Complemental strand, 35922666 - 35922561
Alignment:
| Q |
18 |
tttggtaccattatctcaatttttggagttgatagattgggtaggagagccctttttcttgaaggtggtcttcaaatgctcatttgtcaggtaactatgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35922666 |
tttggtaccattatctcaatttttggagttgatagattgggtaggagagccctttttcttgaaggtggccttcaaatgctcatttgtcaggtaactatgt |
35922567 |
T |
 |
| Q |
118 |
tgtgta |
123 |
Q |
| |
|
|||||| |
|
|
| T |
35922566 |
tgtgta |
35922561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 31 - 112
Target Start/End: Original strand, 36202405 - 36202486
Alignment:
| Q |
31 |
tctcaatttttggagttgatagattgggtaggagagccctttttcttgaaggtggtcttcaaatgctcatttgtcaggtaac |
112 |
Q |
| |
|
||||||||| ||||||||||| | |||||||||||||||||| |||||||||||| |||||||||||| || |||||||| |
|
|
| T |
36202405 |
tctcaatttatggagttgataagtggggtaggagagcccttttccttgaaggtggtgctcaaatgctcatatgccaggtaac |
36202486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University