View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14579_high_24 (Length: 306)
Name: NF14579_high_24
Description: NF14579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14579_high_24 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] scaffold0376 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 16 - 306
Target Start/End: Original strand, 4021557 - 4021847
Alignment:
| Q |
16 |
gaaggaggactcgaagtaaaaaacttgtacttatttcatttaacgttacgaagaaaatggttatggaggtgcattgcggaaaatggtactatttggttcg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4021557 |
gaaggaggactcgaagtaaaaaacttgtacttatttcatttaaagttacgaagaaaatggttatggaggtgcattgcggaaaatggtactatttggttca |
4021656 |
T |
 |
| Q |
116 |
ggttaataaagtataggtacagtccagtttcaggaaaattgctccgtccagataccgtgtagtcgggaaggatagactcgttatggcggcgatatttatg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4021657 |
ggttaataaagtataggtacagtccagtttcaggaaaattgctccatccagataccgtgtagtcgggaaggatagactcgttatggtggcgatatttatg |
4021756 |
T |
 |
| Q |
216 |
ttctattggaaaggcatgtgaagtcgaaccaaactggtttacaaattaagttatgtgagtagtcggaaatggtgaaaagtgaaaacacatt |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
4021757 |
ttctattggaaaggcatgtgaagtcgaaccaaactggtttacaaattaagttaagtgagtagttggaaacggtgaaaagtgaaaacacatt |
4021847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0376 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: scaffold0376
Description:
Target: scaffold0376; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 178 - 255
Target Start/End: Original strand, 5113 - 5190
Alignment:
| Q |
178 |
tcgggaaggatagactcgttatggcggcgatatttatgttctattggaaaggcatgtgaagtcgaaccaaactggttt |
255 |
Q |
| |
|
||||||||| |||||||||||||| |||| |||||||||| || ||||||| |||||||| ||||||||||||||| |
|
|
| T |
5113 |
tcgggaaggttagactcgttatggtggcgtgatttatgttcaataggaaaggtgtgtgaagtggaaccaaactggttt |
5190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University