View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14579_low_18 (Length: 363)
Name: NF14579_low_18
Description: NF14579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14579_low_18 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 80; Significance: 2e-37; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 262 - 349
Target Start/End: Complemental strand, 11397322 - 11397235
Alignment:
| Q |
262 |
cccatattaaaatgctcaaatccctcaagaatacctcattactcaagtctctagccattttagcatgagctgcttcttgagcaaattg |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11397322 |
cccatattaaaatgctcaaatccctcaagaatacctcattactcaagtgtttagccattttagcatgagctgcttcttgagcaaattg |
11397235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 279 - 349
Target Start/End: Original strand, 10732695 - 10732765
Alignment:
| Q |
279 |
aaatccctcaagaatacctcattactcaagtctctagccattttagcatgagctgcttcttgagcaaattg |
349 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10732695 |
aaatccctaacgaatacctcattactcaagtctctagccattttagcatgaactgcttcttgagcaaattg |
10732765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 187 - 234
Target Start/End: Complemental strand, 11397388 - 11397341
Alignment:
| Q |
187 |
tttaacaaccatctcccgaagctcttttaaatgcaaatcaacttcatc |
234 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
11397388 |
tttaacaaccatctcccggagctcttctaaatgcaaatcaacttcatc |
11397341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 10732565 - 10732612
Alignment:
| Q |
187 |
tttaacaaccatctcccgaagctcttttaaatgcaaatcaacttcatc |
234 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||| | |||||||||||| |
|
|
| T |
10732565 |
tttaacaaccatctcccggagctcttctaaatgtacatcaacttcatc |
10732612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 17 - 87
Target Start/End: Complemental strand, 17011528 - 17011458
Alignment:
| Q |
17 |
tgaaatgagttggtagtataggtaatagttatatcttgataacagtgcataatttgattgattgggtgtct |
87 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||| |||| || |||| ||| ||||| ||||||||||||| |
|
|
| T |
17011528 |
tgaaatgagttggtagtataggttatagtgatatattgagaagagtgaatattttgactgattgggtgtct |
17011458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 17 - 87
Target Start/End: Original strand, 136016 - 136086
Alignment:
| Q |
17 |
tgaaatgagttggtagtataggtaatagttatatcttgataacagtgcataatttgattgattgggtgtct |
87 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||| || | || | || ||| ||||| ||||||||||||| |
|
|
| T |
136016 |
tgaaatgagttggtagtataggttatagtgatatattaaaaagattggatattttgactgattgggtgtct |
136086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University