View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14579_low_25 (Length: 313)
Name: NF14579_low_25
Description: NF14579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14579_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 266; Significance: 1e-148; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 302
Target Start/End: Original strand, 44110018 - 44110317
Alignment:
| Q |
1 |
tatagttcaatcagtttcgttgagtttattttacaaaatgcaagagttttaaagcagatcgagattacctgttcgccatttttaccacatggtgtgcctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44110018 |
tatagttcaatcagtttcgttgagtttattttacaaaatgcaagagttttaaagctgatcgagattacctgttcgccatttttaccacatggtgtgcctt |
44110117 |
T |
 |
| Q |
101 |
tgaagaacctggcggatgtcaagaatcaacttgcagacatgagaagatgagacattcagtttaagtaaatannnnnnnnnagtaggaattgaattttctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44110118 |
tgaagaacctggcggatgtcaagaatcaacttgcagacatgagaagatgagacattcagtttaagtaaata--tttttttagtaggaattgaattttctt |
44110215 |
T |
 |
| Q |
201 |
gtctaactttaataaggcgcggttaagttaaatagcttccttcaacaataatttatggggtttgcatttcatgaactgaatcaatttatactagtttata |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44110216 |
gtctaactttaataaggcgcggttaagttaaatagcttccttcaacaataatttatggggtttgcatttcatgaactgaatcaatttatactagtttata |
44110315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 105 - 146
Target Start/End: Complemental strand, 40450254 - 40450213
Alignment:
| Q |
105 |
gaacctggcggatgtcaagaatcaacttgcagacatgagaag |
146 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||| |||| |
|
|
| T |
40450254 |
gaacctggcggatgtcaagaaccaacttgcaggcatgggaag |
40450213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 105 - 146
Target Start/End: Complemental strand, 40507058 - 40507017
Alignment:
| Q |
105 |
gaacctggcggatgtcaagaatcaacttgcagacatgagaag |
146 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||| |||| |
|
|
| T |
40507058 |
gaacctggcggatgtcaagaaccaacttgcaggcatgggaag |
40507017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University