View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14579_low_26 (Length: 312)
Name: NF14579_low_26
Description: NF14579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14579_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 112 - 254
Target Start/End: Original strand, 16645071 - 16645213
Alignment:
| Q |
112 |
acatggatcattcgagtgaggaatcaactttatgaactgatcgagagaaagccaatacatcattaggagcttgagctgtttcaccatttgaaattatgtt |
211 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16645071 |
acatgaatcattcgagtgaggaatcaactttatgaactgatcgagagaaagccaatacatcattaggagcttgagctgtttcaccatttgaaattatgtt |
16645170 |
T |
|
| Q |
212 |
gtcacgaatgatccttttggtcactgtatcactctctaattcc |
254 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
16645171 |
gtcacgaatgatccttttggtcactgtgtcattctctaattcc |
16645213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University