View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457R-Insertion-10 (Length: 320)
Name: NF1457R-Insertion-10
Description: NF1457R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457R-Insertion-10 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 8 - 320
Target Start/End: Complemental strand, 44632527 - 44632206
Alignment:
| Q |
8 |
atttatacaggtctggatacgatggttggaaaccagagagtgtgacagtatatacccataactaccaacctgctacattttactacaatgcttttatccc |
107 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44632527 |
atttatacaggtccggatacgatggttggaaaccagagagtgtgacagtatatacccataactaccaacctgctactttttactacaatgcttttatccc |
44632428 |
T |
 |
| Q |
108 |
taatggtgtttggtatggttttgattattgtcgtggttacttaccctccactgctac---------tgctgctgctgcactctagtgtagttgatcttct |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44632427 |
taatggtgtttggtatggttttgattattgtcgtggttacttaccctccactgctactgctactgctgctgctgctgcactctagtgtagttgatcttct |
44632328 |
T |
 |
| Q |
199 |
tagtttatgaataagataataatgtagttttccaactgtgaaaccctctgttatatgcgggattagtggtccttctataagcccttcttttacatggaaa |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44632327 |
tagtttatgaataagataataatgtagttttccaactgtgaaaccctctgttatatgcgggattagtggtccttctataagcccttcttttatatggaaa |
44632228 |
T |
 |
| Q |
299 |
tgtttgtttgtaggttttactg |
320 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
44632227 |
tgtttgtttgtaggttttactg |
44632206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University