View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457R-Insertion-12 (Length: 279)
Name: NF1457R-Insertion-12
Description: NF1457R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457R-Insertion-12 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 9 - 279
Target Start/End: Original strand, 43653733 - 43654003
Alignment:
| Q |
9 |
gaaacagcagtggtgaaaagtgtagctgccaataaagcaagagcatttcttcttccatcacttgctcttgattctttggcttcaggaattctcacctgct |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43653733 |
gaaacagcagtggtgaaaagtgtagctgccaataaagcaagagcatttcttcttccatcacttgctcttgattctttggcttcaggaattctcacctgct |
43653832 |
T |
|
| Q |
109 |
gagccttgatcaatggtagcttgatacctgaaacccctggtgatgcagcagagggcactgaaatgagctttgcattgagctcagaaccagatatggcata |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43653833 |
gagccttgatcaatggtagcttgatacctgaaacccctggtgatgcagcagagggcactgaaatgagctttgcattgagctcagaaccagatatggcata |
43653932 |
T |
|
| Q |
209 |
gctacaagctaatacacttgagttcattgcagccatgtgtaatggattgctagtttagttctgctgatcga |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43653933 |
gctacaagctaatacacttgagttcattgcagccatgtgtaatggattgctagtttagttctgctgatcga |
43654003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University