View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457R-Insertion-14 (Length: 194)
Name: NF1457R-Insertion-14
Description: NF1457R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457R-Insertion-14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 4e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 4e-86
Query Start/End: Original strand, 9 - 194
Target Start/End: Original strand, 47705315 - 47705500
Alignment:
| Q |
9 |
agtttaaagtacttaagnnnnnnnggaagatattcatacactagtacttctttatcttttcctttccattgatctagtaatggctttctaatcataccat |
108 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47705315 |
agtttaaagtacttaagtttttttggaagatattcatacactagtacttctttatcttttcctttccattgatctagtaatgtctttctaatcataccat |
47705414 |
T |
 |
| Q |
109 |
gttcccctccagcaaagaaagcaagtatagaacgattatttgattctttgcttggaattggtgagctcaacttgtaaccttgtagg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47705415 |
gttcccctccagcaaagaaagcaagtatagaacgattatttgattctttgcttggaattggtgagctcaacttgtaaccttgtagg |
47705500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University