View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457R-Insertion-16 (Length: 164)
Name: NF1457R-Insertion-16
Description: NF1457R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457R-Insertion-16 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 148; Significance: 2e-78; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 9 - 164
Target Start/End: Original strand, 31241339 - 31241494
Alignment:
| Q |
9 |
agctctgccaattttgaaatggtatggcaccaattaaaatgaattagaggaccaacatctagcatatatataataatctacagagtaatactacaaatgt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31241339 |
agctctgccaattttgaaatggtatggcaccaattaaaatgaattagaggaccaacatctagcatatatataataatctacatagtaatactacaaatgt |
31241438 |
T |
|
| Q |
109 |
gaatcttgagtagtagatggttaatatattgtaccttattcatttggctcaagtac |
164 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31241439 |
gaatctttagtagtagatggttaatatattgtaccttattcatttggctcaagtac |
31241494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 4e-27
Query Start/End: Original strand, 24 - 164
Target Start/End: Original strand, 31232383 - 31232524
Alignment:
| Q |
24 |
gaaatggtatggcaccaattaaaatgaattagaggaccaacatctagcatata-tataataatctac--agagtaatactacaaatgtgaatcttgagta |
120 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||| || |||||||||||| | |||| | | | | ||||||||||||||||||| ||||||||| |
|
|
| T |
31232383 |
gaaatggtataacaccaattaaaatgaattagaagactaatatctagcatatagtgtaatcaacaaattaaagtaatactacaaatgtgagtcttgagta |
31232482 |
T |
|
| Q |
121 |
gtagatggttaatatattgtaccttattcatttggctcaagtac |
164 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
31232483 |
gtagatggtta--atattgtaccttattcatttggttcaagtac |
31232524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University