View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457R-Insertion-19 (Length: 132)
Name: NF1457R-Insertion-19
Description: NF1457R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457R-Insertion-19 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 3e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 3e-64
Query Start/End: Original strand, 9 - 132
Target Start/End: Complemental strand, 38750498 - 38750375
Alignment:
| Q |
9 |
tgaatattagaagaattcatctattctcttttcatgtcccaaaaaccaatcattttctacttcgtttaactcgatgcttgcacaaaaggtgtaatatgca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38750498 |
tgaatattagaagaattcatctattctcttttcatgtcccaaaaaccaatcattttctacttcgtttaactcgatgcttgcacaaaaggtgtaatatgca |
38750399 |
T |
|
| Q |
109 |
ataccttctttcatctggttcccc |
132 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
38750398 |
ataccttctttcatctggttcccc |
38750375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University