View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457R-Insertion-20 (Length: 82)
Name: NF1457R-Insertion-20
Description: NF1457R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457R-Insertion-20 |
 | |
|
| [»] chr2 (6 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 70; Significance: 3e-32; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 3e-32
Query Start/End: Original strand, 9 - 82
Target Start/End: Original strand, 8394913 - 8394986
Alignment:
| Q |
9 |
gtctggtgttgcagctgtcacaagcggggaaggtgcaccacttatggctatgaaactgtcctctgctcttttat |
82 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8394913 |
gtctggtgttgcagctgtcacaaacggggaaggtgcaccacttatggctatgaaactgtcctctgctcttttat |
8394986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 3e-32
Query Start/End: Original strand, 9 - 82
Target Start/End: Complemental strand, 8406416 - 8406343
Alignment:
| Q |
9 |
gtctggtgttgcagctgtcacaagcggggaaggtgcaccacttatggctatgaaactgtcctctgctcttttat |
82 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8406416 |
gtctggtgttgcagctgtcacaaacggggaaggtgcaccacttatggctatgaaactgtcctctgctcttttat |
8406343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 70; E-Value: 3e-32
Query Start/End: Original strand, 9 - 82
Target Start/End: Complemental strand, 8412536 - 8412463
Alignment:
| Q |
9 |
gtctggtgttgcagctgtcacaagcggggaaggtgcaccacttatggctatgaaactgtcctctgctcttttat |
82 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8412536 |
gtctggtgttgcagctgtcacaaacggggaaggtgcaccacttatggctatgaaactgtcctctgctcttttat |
8412463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 70; E-Value: 3e-32
Query Start/End: Original strand, 9 - 82
Target Start/End: Complemental strand, 8434634 - 8434561
Alignment:
| Q |
9 |
gtctggtgttgcagctgtcacaagcggggaaggtgcaccacttatggctatgaaactgtcctctgctcttttat |
82 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8434634 |
gtctggtgttgcagctgtcacaaacggggaaggtgcaccacttatggctatgaaactgtcctctgctcttttat |
8434561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 66; E-Value: 8e-30
Query Start/End: Original strand, 9 - 82
Target Start/End: Original strand, 8395156 - 8395229
Alignment:
| Q |
9 |
gtctggtgttgcagctgtcacaagcggggaaggtgcaccacttatggctatgaaactgtcctctgctcttttat |
82 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8395156 |
gtctggagttgcagctgtcacaaacggggaaggtgcaccacttatggctatgaaactgtcctctgctcttttat |
8395229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 45; E-Value: 3e-17
Query Start/End: Original strand, 9 - 77
Target Start/End: Complemental strand, 8431564 - 8431496
Alignment:
| Q |
9 |
gtctggtgttgcagctgtcacaagcggggaaggtgcaccacttatggctatgaaactgtcctctgctct |
77 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||| ||||| ||||||| || |||||||| |
|
|
| T |
8431564 |
gtctggtgttgcagctgtcacaagtggggaagttgcaccacttttggctctgaaactatcttctgctct |
8431496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University