View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_1D_high_24 (Length: 257)
Name: NF1457_1D_high_24
Description: NF1457_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_1D_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 22 - 250
Target Start/End: Complemental strand, 1187966 - 1187738
Alignment:
| Q |
22 |
atgtacttgtactgcaaggaaaggaatgaataggcaaagagggagttgtgcctcttacacatgaaaaaccttcaatttggacataaaaacagctagctca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1187966 |
atgtacttgtactgcaaggaaaggaatgaataggcaaagagggagttgtgcctcttacacatgaaaaaccttcaatttggacataaaaacagctagctca |
1187867 |
T |
 |
| Q |
122 |
cacaatatgacacaattcaacaccagaacggcaaagaatgtgtgtgtacgtacgattcagcatggcattggcattggcatttttaattgaaatttgtcac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1187866 |
cacaatatgacacaattcaacaccagaacggcaaagaatgtgtgtgtacgtacgattcagcatggcattggcattggcatttttaattgaaatttgtcac |
1187767 |
T |
 |
| Q |
222 |
tagatgcaattcatccatcattcatctca |
250 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1187766 |
tagatgcaattcatccatcattcatctca |
1187738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University