View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1457_1D_high_26 (Length: 253)
Name: NF1457_1D_high_26
Description: NF1457_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1457_1D_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 95 - 250
Target Start/End: Complemental strand, 38750498 - 38750343
Alignment:
| Q |
95 |
tgaatattagaagaattcatctattctcttttcatgtcccaaaaaccaatcattttctacttcgtttaactcgatgcttgcacaaaaggtgtaatatgca |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38750498 |
tgaatattagaagaattcatctattctcttttcatgtcccaaaaaccaatcattttctacttcgtttaactcgatgcttgcacaaaaggtgtaatatgca |
38750399 |
T |
 |
| Q |
195 |
ataccttctttcatctggttccccttcatctcttcaggcttataaactccatactc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38750398 |
ataccttctttcatctggttccccttcatctcttcaggcttataaactccatactc |
38750343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University